!~ آخـر مواضيع المنتدى ~!
إضغط علي شارك اصدقائك او شارك اصدقائك لمشاركة اصدقائك!






العودة   شبكة التعليم بالمغرب المنتدى الدراسي منتدى التعليم الثانوي
منتدى التعليم الثانوي دروس لمواد أدبية، علمية وتقنية، عربية l إسلاميات l إجتماعيات l فلسفة l رياضيات l فيزياء l كيمياء l جدع مشترك l أولى باك l ثانية باك

الملاحظات

بناء مفهوم الخبر الوراثي

منتدى التعليم الثانوي

رد
قديم 02-03-2009, 21:07   #1
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي بناء مفهوم الخبر الوراثي

نقره لعرض الصورة في صفحة مستقلة
السلام عليكم و رحمة الله و بركاته

بناء مفهوم الخبر الوراثي

تموضع الخبر الوراثي و طبيعته الكيميائية

بناء مفهوم الخبر الوراثي:تموضعه و طبيعته الكيميائية

قد تتساءل لماذا نبحث عن الخبر الوراثي على مستوى الخلية : حاول أن تعتمد المنطق التالي:
تعلم أن الحياة مجموعة وظائف حيوية وأن هذه الوظائف وراثية وأن كل ما هو وراثي مصدره الخبر الوراثي ادن فهذا الأخير يشكل دعامة الحياة
تعلم أن الخلية هي المسيطرة على الوظائف وبالتالي فالخبر الوراثي يتموضع في الخلية . فأين يتموضع داخل الخلية ؟
للإجابة على هذا السؤال حاول أن تفسر نتائج تجربة التقطيع المنجزة عند Acetabularia
عبارة عن طحلب أخظر وحيد الخلية يعيش متبث فوق الصخور : نقتصر هنا على النوعين A.m و A.c
نقره لعرض الصورة في صفحة مستقلة ------------------------------------نقره لعرض الصورة في صفحة مستقلة
تجربة1: فصل الطحلب إلى جزئين: الجزء القاعدي به نواة والجزء العلوي بدون نواة
.تفسير نتائج التجربة:
ضمور الجزء العلوي يفسر بعدم توفره على المادة الوراثية نمو الجزء القاعدي وتعويضه لقبعة جديدة يفسر بتوفره على المادة الوراثية
تجربة2:
نقره لعرض الصورة في صفحة مستقلة
لاحظ أن الجزء القاعدي ينمو ويجدد قبعة بمواصفات النوع المعطي للنواة مما يدل على أن شكل القبعة يتحدد من خلال
معلومات وراثية متمو ضعة في نواة الخلية

استنتاج :المادة الوراثية متمو ضعة داخل نواة الخلية
ما هي طبيعة المادة الوراثية؟
نعلم الأن أن الخبر الوراثي يوجد في النواة : النواة تتحكم في الوظائف التي تتم على مستوى الجبلة الشفافة
(سنحاول فيما بعد معرفة كيف يتم التواصل بين النواة والسيتوبلازم ) فما هي الطبيعة الكيميائية للمادة الوراثية؟
حاول أن تجد تفسير لنتائج تجارب
Griffith.
قام بحقن مجموعات من الفئران بنوعين من المكورات الثنائية الرئوية(بكتيريات) حسب الظروف التجريبية الممثلة أسفله.

نقره لعرض الصورة في صفحة مستقلة

تجارب Griffith

نقره لعرض الصورة في صفحة مستقلة

لاحظ ان المكورات الثنائية الرئوية نوع S تسببت في موت الفئران فهي ادن مميتة( حادة) عكس النوع R لم تتأثر به الفئران فهو ادن غير حاد
نقره لعرض الصورة في صفحة مستقلة
بإيجادك لتفسير مقنع لنتائج التجربة الثالثة ل Griffith ستلاحظ أن R تحول إلى S : هذا التحول ليس تلقائي بل هناك علة محولة وهي جزء من الخبر الوراثي للنوع S بحيث اكتساب النوع Rلصفة النوع S( المحفظة ) سببه اكتساب جزء من مادته الوراثية والموجودة
ضمن بقايا S .البحث عن العلة المحولة هو البحث عن المادة الوراثية. فما طبيعتها ؟

تذكير: بقايا البكتيرية S تتكون من دهنيات - بروتيدات - ونوعين من الأحماض الأزوتية : ARN و ADN
تمت معالجة بقايا S بمختلف أنزيمات هضمية بهدف التخلص من مختلف المواد المكونة للبكتيرية قبل حقنها مع محلول به النوع R لمجموعة من الفئران
لاحظ أن العلة المحولة تختفي فقط في حالة غياب ADN مما يعني أن هذه المادة تشكل العلة المحولة.
نقره لعرض الصورة في صفحة مستقلة
لاحظ أن العلة المحولة تختفي بعد معالجة بقايا S بالأنزيم الهاضم لمادة ADN أي أن سبب اكتساب النوع R للعلبة هو اكتسابه لجزء من ADN النوع S الموجود ضمن البقايا

استنتاج عام:
الخبر الوراثي يوجد في النواة وهو عبارة عن مادة
الحمض النووي الريبوزي ناقص أكسجين
ADN .
دور
ADN في تكاثر الحمات(الفيروسات)

ملحوظة: بعض الحمات تتكاثر بفضل
ARN عوض ADN مثل حمة السيدا(VIH )





الموضوع الأصلي : بناء مفهوم الخبر الوراثي || الكاتب : SelOua || المصدر : شبكة التعليم بالمغرب

 

__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 02-03-2009, 21:09   #2
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي نقل الخبر الوراثي من الخلية الأم إلى الخلية البنت



نقل الخبر الوراثي من الخلية الأم إلى الخلية البنت
نقل الخبر الوراثي أثناء الانقسام غير المباشر

الأهداف المعرفية:
تعرف مراحل الانقسام غير المباشر عند كل من الخلية النباتية والخلية الحيوانية.
فهم دور الصبغيات في نقل الخبر الوراثي من الخلية الأم إلى الخلية البنت.
فهم المميزات الوراثية للانقسام غير المباشر.
الانقسام غير المباشر عند الخلية النباتية:
إليك صور ملاحظة بالمجهر لخلية جدر البصل خلال مختلف مراحل الانقسام غير المباشر: حاول أن تستنتج أهم التغيرات الحاصلة على مستوى نواة الخلية ورتب الصور حسب تسلسلها الزمني.
نقره لعرض الصورة في صفحة مستقلة

لاحظ أن أهم التغيرات تخص النواة : اختفاء النويات والغشاء النووي ثم اتخاذ النواة لمظهر خييطي : الصبغيات (خييطات تظهر في النواة أثناء الانقسام)
مراحل الانقسام غير المباشر
الصورة b: لاحظ أن حدود النواة واضحة وبها نويات المادة النووية التي تظهر قاتمة عبارة عن الصبغين:الخلية هنا في طور السكون (لم تشرع بعد في الانقسام)
الصورة c : لاحظ تغير مظهر النواة أصبح خييطي وحدودها تلاشت(اختفاء النويات والغشاء النووي) الخييطات عبارة عن الصبغيات. Chromosomes:المرحلة التمهيدية من الانقسام.
الصور d.fوg: لاحظ وضوح الصبغيات وتموضعها على شكل صفيحة استوائية :الخلية هنا في الطور الاستوائي من الانقسام .
الصور h وa: لاحظ انفصال مجموعتين من الصبغيات و تصاعد قطبي لكل مجموعة :الخلية هنا في الطور الانفصالي من الانقسام.
الصورة e: لاحظ تشكل نواتين جديدتين في قطبي الخلية الأم انطلاقا من الصبغيات الأصلية ثم ظهور جدار جديد يفصل السيتوبلازم الأصلي إلى جزئين نحصل بذلك على خليتين بنتين:الطور النهائي.

خلاصة

يتم الانقسام عبر مراحل متسلسلة: التمهيدية-الاستوائية – الانفصالية ثم النهائية. أهم ما يميز المراحل الثلاث الأولى :ظهور الصبغيات تموضعها على شكل
صفيحة استوائية ثم انفصالها إلى مجموعتين (انقسام النواة إلى نواتين) المرحلة النهائية تتميز بانقسام السيتوبلازم لنحصل في النهاية على خليتين.
حالة الخلية الحيوانية: تظهر الوثيقة التالية رسوم تفسيرية لمراحل الانقسام غير المباشر عند الخلية الحيوانية.
نقره لعرض الصورة في صفحة مستقلة

لاحظ أن الخلية الحيوانية تتميز بوجود جسيم مركزي الذي يشكل مصدر النجيمتان خلال الطور التمهيدي من الانقسام.
غياب الجدار الهيكلي يجعل انقسام السيتوبلازم عملية سهلة وتتم بواسطة الاختناق الاستوائي.
بالنسبة لتسلسل أحداث الانقسام تتم وفق نفس المراحل المشار إليها سابقا.
لاحظ أن صبغيات الخلية الأم ناقلة للخبر الوراثي إلى الخلايا البنات فهي ادن تشكل دعامة الخبر الوراثي
مفهوم الخريطة والصيغة الصبغيتين:
نقره لعرض الصورة في صفحة مستقلة

الخريطة تعبر عن صبغيات الخلية مرتبة من الأكبر إلى الأصغر :
لاحظ أن صبغيات الخريطة'' ب'' مرتبة على شكل أزواج أي أن لكل صبغي مماثله نقول أن الخلية هنا ثنائية الصيغة الصبغية ونرمز لها ب 2n هنا 2n=46
لاحظ أن صبغيات الخريطة ''أ'' مرتبة على شكل أفراد أي أن كل صبغي ممثل بنمودج واحد :الخلية هنا أحادية الصيغة الصبغية نرمز لها ب n هنا
ما هي العلاقة بين الصبغيات وADN؟
خلال طور السكون تظهر الصبغيات على شكل عقود من اللؤلؤ كل عقد مكون من ADN وبروتينات تنعت بالهستونات
مع بداية الانقسام تتكدس الخييطات لتصبح الصبغيات واضحة خلال فترات الانقسام حيث يصبح التكدس في أوجه خلال الطور الاستوائي.
نقره لعرض الصورة في صفحة مستقلة

1:مظهر خييطات الصبغين خلال طور السكون
2:أنظر البنية الجزيئية لمادة ADN
3:مظهر الصبغي خلال فترة الانقسام
كيف تتطور كمية ADN خلال الدورة الخلوية؟
نقره لعرض الصورة في صفحة مستقلة

الدورة الخلوية تعبر عن المدة الفاصلة بين انقسامين متتاليين وتشمل طور السكون(G2-S-G1) وفترة انقسام(M)

نقره لعرض الصورة في صفحة مستقلة

لاحظ أن كمية ADN عند الخلية البنت هي نفس الكمية عند الخلية الأم بفضل التضاعف الملاحظ خلال المرحلة S من طور السكون.
فما هي آلية تضاعف ADN وما هي خاصية هذا النمط من التوالد؟ للإجابة على هذا السؤال نقترح نتائج تجارب Stahl و Messelson

نقره لعرض الصورة في صفحة مستقلة

تفسير النتائج

ADN الوسط الأول ثقيل لأن ألأزوت المدمج في كلا الشريطين من النوع الثقيل N15.
ADN الخلايا الناتجة عن انقسام الأولى في الوسط الثاني من النوع الهجين أي وسيط بين الخفيف و الثقيل مما يعني أنه تم دمج أزوت خفيف الى جنب الأزوت الأصلي الثقيل.
ADN المحصل عليه بعد الانقسام الثاني في نفس الوسط نوعان نوع خفيف ونوع هجين مما يعني أنه أثناء تضاعف ADN يحافظ دائما على جزء أصلي وتتم بلمرة جزء جديد: تنعث الالية بالنصف محافضة .لفهم أكثر اليك عزيزي الرسوم المفسرة لالية النسخ النصف المحافظ.
نقره لعرض الصورة في صفحة مستقلة

الشريط الأصلي يلعب دور القالب أثناء عمل أنزيم البلمرة (ADN polymérase) مما يجعل ADN المحصل عليه مطابق للأصلي.أثناء المرحلة الانفصالية من الانقسام الخلوي كلا الخليتين البنتين تحصل ليس فقط على نفس كمية ADN الخلية الأم (بفضل التضاعف) لكن كذلك على نفس نوع ADN بفضل الآلية النصف المحافظة :يحافظ على نفس الخبر الوراثي إذن من الخلية الأم إلى الخلية البنت فالانقسام الخلوي توالد مطابق للأصل( التلميم Clonage).

__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 02-03-2009, 21:11   #3
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي آلية تعبير الخبر الوراثي مفهوم المورثة و الحليل:

آلية تعبير الخبر الوراثي
مفهوم المورثة و الحليل:
نفس الصفة الوراثية تأخذ عدة مظاهر خارجية مما يدل على أن المحتوى الوراثي المحدد لهذه الصفة يخضع لتغيرات بفعل الطفرات.
مثال لون البدور عند الجليان petit pois
مظهر خارجي أخضر نقره لعرض الصورة في صفحة مستقلة مظهر خارجي أصفر نقره لعرض الصورة في صفحة مستقلة لاحظ أن الأخضر و الأصفر يعبران على مظهرين مختلفين لنفس الصفة(اللون )
الجزء المسؤول عن اللون على مستوى ADN ادن يختلف محتواه الوراثي عند النبتتين : يشكل هذا المحتوى الحليل Allèle
المورثة: ادن عبارة عن جزء من ADN يرمز إلى صفة وراثية(اللون مثلا) والحليل عبارة عن المحتوى الوراثي لهذا الجزء ويرمز إلى مظهر خارجي معين
( الأخضر أو الأصفر مثلا ) يمكن المرور من حليل لأخر بفعل حدوث تغير فجائي ينعت بالطفرة.
مفهوم المظهر الخارجي :
مثال: فقر الدم المنجلي : مرض وراثي يتميز باتخاذ الكريات الحمراء شكل منجلي عند الشخص المصاب.
فما هو سبب هذا الشكل مقارنة مع الشكل العادي للكريات الحمراء - لفهم سبب اختلاف شكل الكريات الحمراء عند الشخصين نقوم بمقارنة محتوى هاذين الصنفين من الخلايا ( مع التذكير بأن محتوى الكريات الحمراء يتجلى في الخضاب الدموي وهو بروتين صنف الكريونات )
البروتين = سلسلة من الأحماض الأمينية
نقره لعرض الصورة في صفحة مستقلة

لنقارن ادن الخضاب الدموي الموجود بداخل الكريات الحمراء المنجلية(HbS) بالخضاب الدموي للكريات ذات الشكل العادي(HbA):

Val- His- Leu- Thr- Pro- Glu- Lys حالة الشخص السليم.
Val- His- Leu- Thr- Pro- Val- Lys حالة الشخص المصاب
سنقتصر على تمثيل جزء من السلسلة B وهو الجزء المميز للحالتين ( الأجزاء الغير ممثلة لم يعاين أي اختلاف بين الشخصين السليم والمصاب.) لاحظ أن الحمض ألأميني رقم 6 في السلسلة العادية هو Glucine وفي السلسلة الغير عادية هو Valine مما يعني أن سبب الاختلاف يتجلى في استبدال حمض أميني بأخر. هذا الاستبدال يجعل جزيئات الخضاب نوع HbS تلتصق فيما بينها بعد تحريرها للأكسجين مما يفقدها خصائصها الأصلية(حالة مذابة) هذا التصلب يغير في شكل الكريات الحمراء لتصبح منجلية.
ما هي عواقب هذا التغير بالنسبة لخصائص الخضاب الدموي؟
قدرة الكريات الحمراء على نقل الأكسجين مرتبطة بسهولة حركتها .بسبب التصاق جزيئات الخضاب الدموي فيما بينها تتخذ الكريات الحمراء شكل منجلي مما يجعل قدرتها على نقل الأكسجين ضعيفة بفعل حركتها الصعبة داخل العروق.
استنتاج : سبب فقر الدم ادن خلل في بروتين الكريات الحمراء مما يعني أن المظهر الخارجي على مستوى الجزيئي عبارة عن 17
فما هو سبب استبدال Glu ب Val في السلسلة الغير عادية؟
لنقارن جزء ADN المناسب عند الشخصين:

جزء ADN عند الشخص السليم:
CACGTGGAATGAGGTCTCCTC
GTGCACCTTACTCCAGAGGAG
نفس الجزء عند الشخص المصاب:
CACGTGGAATGAGGTCACCTC
GTGCACCTTACTCCAGTGGAG

لاحظ أن النكليوتيد رقم 17 T استبدل ب A مما نتج عنه استبدال Glucine ب Valine على مستوى السلسلة B للخضاب الدموي HbS
استنتاج : تسلسل النكليوتيدات ادن على مستوى ADN يرمز إلى تسلسل الأحماض الأمينية على مستوى البروتين: هناك ادن رمز وراثي
خلاصة عامة:
عمل المورثة يقتصر في التحكم في تسلسل الأحماض الأمينية على مستوى البروتينات المنتجة من طرف الخلايا.آلية تعبير الخبر الوراثي يتجلى ادن في آلية تركيب البروتينات.
تركيب البروتينات:
المورثة توجد داخل النواة وعملية تركيب البروتين تتم في السيتوبلازم :التواصل بين النواة والسيتوبلازم يتم عن طريق ARNm- تتم العملية ادن عبر مرحلتين

*الاستنساخ: تشكل ARNm انطلاقا من أحد شريطي ADN.

نقره لعرض الصورة في صفحة مستقلة


نقره لعرض الصورة في صفحة مستقلة

ARNm المحصل عليه
AACCCGAUUGUGCAGUC 3' 5'


الترجمة : تتم في السيتوبلازم بفضل الجسيمات الريبية حيث تترجم كل وحدة رمزية إلى حمض أميني محدد :يشمل الرمز الوراثي على 64 وحدة رمزية ترمز إلى 20 حمض أميني مختلف مما يعطي لكل حمض أكثر من وحدة رمزية مناسبة :يتميز الرمز بالتكرار.3 وحدات ليس لها معنى تعرف بوحدات قف Stop على اعتبار أنها سبب توقف عملية الترجمة.
المبدأ: أكتب الوحدة الرمزية في المكان المناسب ثم أضغط على OK
مثال: UUUAUAAAACCGCGU 3' 5' ARNm
بعد الترجمة نحصل على السلسلة الببتيدية التالية
Phe – Ile – Lys – Pro - Arg



__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 02-03-2009, 21:13   #4
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي الأهمية الوراثية للانقسام الاختزالي والإخصاب

الأهمية الوراثية للانقسام الاختزالي والإخصاب

نقل الخبر الوراثي أثناء التوالد الجنسي
يتميز التوالد الجنسي بحدوث ظاهرتين لهما أهمية وراثية بالغة:الانقسام الاختزالي و الإخصاب, إليك تذكير بأهمية الظاهرتين:
I – الانقسام الاختزالي: يهدف إلى اختزال الصيغة الصيغية من 2n إلى n . فما هي خصائصه مقارنة بالانقسام غير المباشر؟
الانقسام الاختزالي عبارة عن مجموع انقسامين متتاليين كلاهما يتم عبر أربع مراحل:
- الانقسام المنصف division réductionnelle I
- الانقسام التعادلي division équationnelle II
سنقتصر هنا على المراحل المميزة للانقسام المنصف مقارنة مع الانقسام غير المباشر: لاحظ الطور الاستوائي في حالة الانقسامين
المنصف و الغير المباشر :
في حالة الطور الاستوائي I : لاحظ تموضع الصبغيات وهي في حالة اقتران على شكل رباعيات هذا التموضع المميز مؤشر على استعداد كل صبغي الانفصال عن مماثله خلال الطور الانفصالي. (الاستوائية I = استوائية الانقسام المنصف ).

نقره لعرض الصورة في صفحة مستقلة


خلال الطور الانفصالي للانقسام غير المباشر لاحظ تشقق الجزيء المركزي وانفصال كل صبغي ابن عن الأخر(صبيغيات سابقا)
نحصل في النهاية على خليتين بنتين هنا ب 2n=4

نقره لعرض الصورة في صفحة مستقلة


خلال الطور الانفصالي I(المنصف) ينفصل كل صبغي عن مماثله (الطلاق) نحصل في النهاية على خليتين كلاهن ب n=2.
لاحظ أنه في نهاية الانقسام المنصف كل صبغي لا زال مكون من صبيغيين مما يستوجب حدوث انقسام ثاني:الانقسام التعادلي
الانقسام التعادلي: يهدف إلى استعادة كل
n=2 لوضعه الأصلي أي مكون من خييط واحد ( صبيغي) فهو لا يختلف عن الانقسام غير المباشر
يتم في 4 مراحل:التمهيدية II –الاستوائية II – الانفصالية II و النهائية II .
أنقر هنا لملاحظة الظاهرة

نقره لعرض الصورة في صفحة مستقلة


تذكر أن المحتوى الوراثي للصبغيين المتماثلين يختلف مما يعني أن الخلايا الناتجة عن الانقسام الاختزالي تختلف من حيث المحتوى الحليلي
أثناء الطور الانفصاليI يحدث انفصال الصبغيات المتماثلة فيما بينها بشكل عشوائي مما يحدث تخليط حليلي بيصبغي ينتج عنه تنويع وراثي للخلايا المحصل عليها في نهاية الانقسام الاختزالي.

نقره لعرض الصورة في صفحة مستقلة


عكس الانقسام غير المباشر الذي يعتبر توالد مطابق للأصل بحيث نحصل على خلايا مطابقة وراثيا للخلية الأم ( اللمة clone ).
خلال الطور التمهيدي I وأثناء تزاوج الصبغيات المتماثلة فيما بينها يمكن أن يحدث تقاطع بينهما مما ينتج عنه تبادل قطع متماثلة
تعرف الظاهرة بالعبور الصبغي .ينتج عن هذه الظاهرة تخليط حليلي ضمصبغي يزيد من تنوع الخلايا في نهاية الانقسام.

نقره لعرض الصورة في صفحة مستقلة


خلاصة: بفضل كل من الانقسام الاختزالي والاخصاب يحافظ على تباث الصيغة الصبغية من جيل لأخر كما تساهم الظاهرتين في تنويع خلف نفس الجيل(التخليطين البصبغي والضمصبغي)

نقره لعرض الصورة في صفحة مستقلة


مفهوم الدورة الصبغية وكيفية انجازها:
تعبر عن تعاقب الطور n و2n من جيل لأخر بفعل تعاقب ظاهرتي الانقسام الاختزالي و الإخصاب:تنسب الدورة لأحد الطورين أو لكلاهما حسب طول مدة حياته.
تذكر أن الانقسام الاختزالي يضع حد للطور 2n ويشكل تاريخ ميلاد الطور n .
...........الإخصاب يضع حد لحياة الطور n و يشكل تاريخ ميلاد الطور 2n.
...........الانقسام غير المباشر لايأثر في الصيغة الصبغية وبالتالي يمدد في حياة الطور.

نقره لعرض الصورة في صفحة مستقلة نقره لعرض الصورة في صفحة مستقلة

لتحديد نمط الدورة حاول أن تتعرف على الظواهر المشار إليها وتأمل أي الطورين سائد:مدة حياته طويلة –تنسب له الدورة –

نماذج الدورات الصبغية:
نقره لعرض الصورة في صفحة مستقلة نقره لعرض الصورة في صفحة مستقلة نقره لعرض الصورة في صفحة مستقلة

أثناء انجازك للدورة الصبغية تذكر أنك مطالب بما يلي:
- تمثيل تعاقب الطورين 2n و n .
- إظهار أهمية كل طور حسب مدة حياته.
- توضيح التموضع الصحيح لظاهرتي الانقسام الاختزالي و الإخصاب.
- تحديد نمط الدورة.

__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 02-03-2009, 21:15   #5
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي القوانين الاحصائية

القوانين الاحصائية
انتقال الصفات الوراثية عند الكائنات الثنائية الصيغة الصبغية
بعض المعطيات التقنية:
عند الكائن الثنائي الصيغة الصبغية ( 2n) كل صبغي له مماثله أي أن الصبغي ممثل بنموذجين مماثلين مما يعني أن كل مورثة ممثلة بزوج حليلي
مثال: المورثة المسؤولة عن لون البدور عند الدرة . لنرمز للزوج الحليلي المسؤول عن لون البدور ب N(حليل يرمز إلى اللون الأسود) و j (اللون الأصفر)

نقره لعرض الصورة في صفحة مستقلة

النمط الوراثي بالنسبة لصفة اللون يعبر عن المحتوى الحليلي للمورثة المسؤولة عن اللون هنا يكتب كالتالي: Nj
لاحظ أن المحتوى الحليلي للصبغيين المتماثلين مختلف تنعث هذه السلالة بكونها هجينة (مختلفة الأمشاج) أو سلالة غير نقية.

نقره لعرض الصورة في صفحة مستقلة

لاحظ أن هنا المحتوى الحليلي للصبغيين المتماثلين متجانس نرمز للنمط الوراثي هنا ب N//N أو ب j//j
السلالتين هنا نقيتين بالنسبة للصفة المدروسة ( متشابهة الأمشاج ).
تعلم أن كل حليل يرمز الى مظهر خارجي معين . نرمز لهذا المظهر ب : ل[ N ] ( نبتة ببدور سوداء) أو ل[ j ] ( نبتة ببدور صفراء.

نقره لعرض الصورة في صفحة مستقلة

نرمز لجيل الآباء ب P1 و P2 ولأفراد الجيل الأول ب F1 ,الجيل الثاني ب F2 ..........
انتقال زوج حليلي ( مورثة واحدة): الهجونة الأحادية.
يقصد بالهجونة تزاوج بين سلالتين نقيتين تختلف في صفة واحدة (أحادية) أو في صفات (هجونة متعددة) حيث نحصل على أفراد هجينة.
الأشكاليات المطروحة هنا:
الخلف يرث من كلا الأبوين حليل مختلف كلا الحليلين يرمز الى مظهر خارجي لنفس الصفة مختلف عن الأخر
فكيف سيكون المظهر الخارجي للخلف الهجين (أفراد الجيل F1
الحل : لاحظ مظهر الجيل F1 جيدا : - إذا كان مظهره هو مظهر أحد الأبوين يمكنك القول أن هناك سيادة حليلية ( الحليل السائد هو المسؤول عن مظهر F1)
مثال: تزاوج بين سلالتين نقيتين من نبتة كاسيية البدور – سلالة بزهور بنفسجية وأخرى بزهور بيضاء

نقره لعرض الصورة في صفحة مستقلة

- إذا لاحظت أن مظهر F1 وسيط بين مظهري الأبوين يمكنك القول أن هناك سيادة حليلية مشتركة.
مثال: تزاوج بين سلالتين نقيتين من نبتة شب الليل – سلالة بزهور بيضاء و سلالة بزهور حمراء

نقره لعرض الصورة في صفحة مستقلة

في حالة السيادة الحليلية قد تظهر الصفة المتنحية من جديد في الجيل F2 .
التفسير : أثناء تشكل أمشاج الجيل F1 ينفصل الحليل السائد عن الحليل المتنحي من جديد وأثناء الإخصاب تتشكل التركيبات الوراثية من جديد فنحصل على j//j

نقره لعرض الصورة في صفحة مستقلة

بعض المورثات عند الكائنات الثنائية الصيغة الصبغية مميتة( تؤدي إلى موت الفرد قبل أو بعد ولادته)
بعض الحليلات تخلق مشاكل صحية للأفراد الحاملة له . الفرد المتشابه للاقتران بالنسبة لهذا الحليل يموت إما قبل أول بعد ولادته : المورثة مميتة.
الحل: يمكن التعرف على المورثة المميتة من خلال نتائج التزاوج بين هجينين : F1 X F1

نقره لعرض الصورة في صفحة مستقلة

لاحظ أن النتائج المتوقعة نظريا ليست هي النتائج التجريبية ( المحصل عليها ) يفسر ذلك بكون المورثة مميثة هنا بسبب الحليل j (فقط الأفراد المتشابهة الاقتران بالنسبة لهذا الحليل تموت).
استنتاجات

القانون الأول : في حالة تجانس أفراد الجيل الأول F1 فالأبوين من سلالة نقية . يمكنك هذا القانون من الاستنتاجات التالية :

نقره لعرض الصورة في صفحة مستقلة

اذا لاحظت أن مظهر الخلف متجانس (نفس المظهر عند جميع الأفراد) فالنمط الوراثي للأبوين نقي – الاتجاه 1 –
اذا تأكدت من نقاوة النمط الوراثي للأبوين يمكنك التنبئ بتجانس المظهر الخارجي للخلف – الاتجاه 2 –
القانون الثاني : نقاوة الأمشاج تحتم انفصال الحليل السائد عن الحليل المتنحي أثناء تشكل أمشاج السلالة الهجينة مما يسبب ظهور الصفة المتنحية من جديد في الجيل الثاني F2 .
الحالة الاستثنائية للقانون الأول
الحصول على جيل غير متجانس رغم نقاوة السلالتين الأبويتين : كيف يمكن تفسير هذا الاستثناء ؟

نقره لعرض الصورة في صفحة مستقلة

عدم تجانس أفراد الجيل الأول رغم نقاوة الأبوين يفسر بكون أحد الأبوين متغاير الأمشاج (الذكر) رغم نقاوته بالنسبة لصفة لون العيون.
يعني أن المورثة محمولة على صبغي جنسي.
تفسير : الصبغيات الجنسية عند الذكر غير متماثلة وبالتالي فالمورثة ممثلة عنده بحليل واحد أي أن الذكر ينتج نوعين من الأمشاج مما يفسر عدم تجانس F1

نقره لعرض الصورة في صفحة مستقلة

انتقال زوجين حليليين ( مورثتين) : الهجونة الثنائية.
قد تكون المورثتين مستقلتين ( كل مورثة محمولة على صبغي خاص بها) أو مرتبطتين ( كلا المورثتين متموضعتين في نفس الصبغي)
1- الحالة الأولى: حالة مورثتين مستقلتين. مثال: لون وشكل البدور عند نبتة البدور.
المورثة المسئولة عن اللون لها الزوج الحليلي التالي: Jيرمز إلى اللون الأصفر و jيرمز إلى اللون الأخضر.
المورثة المسئولة عن الشكل لها الزوج الحليلي التالي: R يرمز إلى الشكل المستدير و r يرمز إلى الشكل المتجعد.

نقره لعرض الصورة في صفحة مستقلة

لاحظ أن الجيل الأول متجانس وله مظهر أحد الأبوين بالنسبة للصفتين معا : الأبوين من سلالة نقية والحليلات R وJ سائدين – r وj حليلين متنحيين.
لتحديد تموضع المورثثين لابد أن يكون أحد الأبوين هجين أوكلاهما : يمكن انجاز التزاوج الاختباري أو تزاوج بين هجين X هجين

نقره لعرض الصورة في صفحة مستقلة

لاحظ أن النتائج المحصل عليها عند الجيل F2 تدل على أن الفرد الهجين أنتج 4 أنواع من الأمشاج بنسب متكافئة مما يدل على أن الانفصال الحليلي (خلال الانفصالية I ) تم بشكل عشوائي أي أن تنويع أمشاج الهجين هنا ناتج عن التخليط الحليلي البيصبغي: المورثثين ادن مستقلتين gènes indépendant
يظهر ذلك بشكل أسهل بتحليل نتائج التزاوج الاختباري:

نقره لعرض الصورة في صفحة مستقلة

نحصل في الجيل F'1 على أربع مظاهر خارجية بنسب متكافئة: مظهرين أبويين([RJ] ول[rj])بنسبة 50% و مظهرين جديدي التركيب([Rj]و[rJ])50%


التفسير الصبغي لنتائج F'1
نقره لعرض الصورة في صفحة مستقلة

بانجازك لشبكة التزاوج ستحصل على 4 مظاهر خارجية بنسب متكافئة.
استنتاج: القانون الثالث : في حالة انتقال صفتين أو أكثر يكون الانفصال الحليلي مستقل أي أن كل زوج حليلي مستقل عن الأزواج الأخرى:المورثات مستقلة.
2- الحالة الاستثنائية للقانون الثالث: حالة الأزواج الحليلية المرتبطة بنفس الصبغي.- مورثتين مرتبطتين - .
مثال: الزوج الحليلي المسؤول عن لون الجسم والزوج الحليلي المسؤول عن طول الأجنحة عند حشرة دبابة الخل.

نقره لعرض الصورة في صفحة مستقلة

بتطبيقك للقانون الأول حاول أن تجد الاستنتاجات المناسبة؟؟؟؟...................................... ..............
هذه النتائج لا تمكنك من تحديد تموضع المورثتين . لننجز ادن التزاوج الاختباري: أنثى ثنائية التنحي × ذكر هجينة للصفتية

نقره لعرض الصورة في صفحة مستقلة

لاحظ هنا أن النتائج المحصل عليها عند الجيل F'1 كلها أبويية بنسبة 100% يفسر ذلك بارتباط مطلق للمورثتين أي أن G (المورثة1)وL(المورثة2) من جهة وأن g وl من جهة ثانية لم ينفصلا رغم انفصال كل صبغي عن مماثلة أثناء الانقسام المنصف(تشكل الأمشاج الأبوين).
نعيد نفس التزاوج الاختباري باختيار هذه المرة أنثى هجينة × ذكر ثنائي التنحي.

نقره لعرض الصورة في صفحة مستقلة

لاحظ أهناك 17% من الحالات الاستثنائية للارتباط المطلق مما يعني حدوث ظاهرة العبورالصبغي أثناء اقتران كل صبغي بمماثله ( نتج عنه تخليط ضمصبغي)
التفسير الصبغي للانفصال الحليلي أثناء تشكل أمشاج أنثى الجيل F1

نقره لعرض الصورة في صفحة مستقلة

في حالة المورثتين المرتبطتين يمكن تحديد المسافة بينهما وانجاز الخريطة العاملية: لكي يتم تبادل حليلات المورثتين بين الصبغيين المتماثلين يشترط ليس فقط حدوث العبور لكن يشترط في العبور أن يتم في المجال الفاصل بين المورثتين. احتمال حدوث العبور(نسبة المظاهر الجديدة) في هذا المجال مرتبط ادن بهذه المسافة

المسافة بين المورثتين= نسبة المظاهر الخارجية المعادة التركيب نقره لعرض الصورة في صفحة مستقلة

لاحظ أن العبورين 1 و 2 لم تنج عنهما تخليط حليلات المورثتين المدروستين عكس العبور 3 لأنه حدث في المجال الفاصل بين المورثتين.
في الحالة المدروسة حصلنا على 17% من المظاهر الجديدة التركيب ادن المسافة الفاصلة بين المورثتين تقدر ب 17 سنتيمرغان centimorgan(cmg)
1%من المظاهر الجديدة التركيب = 1cmg

1%من المظاهر الجديدة التركيب = 1cmg نقره لعرض الصورة في صفحة مستقلة

__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 02-03-2009, 21:19   #6
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي الهندسة الوراثية وتطبيقاتها في مجالات الصيدلة والفلاحة


الهندسة الوراثية وتطبيقاتها في مجالات الصيدلة والفلاحة


التعريف: تقنيات تتجلى في عزل مورثة ذات منفعة من خلية ونقلها إلى خلية عائلة بهدف تغيير هذه الخلية وراثيا.
I - كيف يمكن ادن عزل مورثة من خلية ونقلها إلى خلية عائلة ؟ وما هي أدوات الهندسة الوراثية ؟
1- عزل المورثة المرغوب فيها (ذات منفعة خاصة )
1-1- تجزيء ADN:
نقره لعرض الصورة في صفحة مستقلة

تذكر أن المورثة جزء من ADN وأن هذا الأخير متمو ضع داخل نواة الخلية.لبلوغ هذه المورثة لابد من هرس الخلايا والتخلص من الغشائين .

نقره لعرض الصورة في صفحة مستقلة

الخطوة المالية تتجلى في تجزيء ADN بهدف عزل المورثة المرغوب فيها: نستعمل لهذا الغرض نوع من الأنزيمات تعرف بأنزيمات الفصل. مثال أنزيم الفصل ECORI

نقره لعرض الصورة في صفحة مستقلة

بعض النماذج الأخرى من أنزيمات الفصل :المتتالية المرغوب فيها ليست مجهولة وبالتالي فأنزيم الفصل المناسب يتحدد حسب مواقع القطع المؤدية للمورثة

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة

تذكر أننا نتوفر على معلومات كافية حول الجزء المبحوث عنه ضمن الأجزاء الناتجة عن تجزيء ADN.
في البداية لابد من فصل الأجزاء فيما بينها: نستعمل تقنية الهجرة الكهربائية Elèctrophorése .
بعد ذالك يتم فصل مختلف أشرطة الأجزاء فيما بينها ونسلط عليها ARN مجس (له القدرة الارتباط بجزء ADN المبحوث عنه)


نقره لعرض الصورة في صفحة مستقلة

1-2: النسخ العكسي: يمكن الحصول على المورثة المرغوب فيها كذلك من خلال ARNm باستعمال أنزيم خاص يعرف بأنزيم النسخ العكسي

نقره لعرض الصورة في صفحة مستقلة

نحصل على ADN أحادي اللولب بوجود النيكليوتيدات الأربع المكونة ل ADN وبوجود أنزيم البلمرة ADN polymérase نحصل على اللولب الثاني.

نقره لعرض الصورة في صفحة مستقلة

مثال: لنعتبر جزء من ARNm بفضل أنزيم النسخ العكسي نحصل على ADN أحادي اللولب التالي وبفضل أنزيم البلمرة
ADN polymérase
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
2- تلميم المورثة المعزولة : لتفادي ضياع المورثة نقوم باستنساخها ( التلميم ) نستعمل لهذا الغرض تقنية PCR .

نقره لعرض الصورة في صفحة مستقلة

المبدأ: تدبدب الحرارة خلال دورة محددة بين 40 و90 درجة: في حرارة 90 درجة ينفصل شريطي المورثة فيما بينهما (تلاشي الروابط الهيدروجينية) في حرارة 40 درجة يقوم ADN polymérase ببلمرة شريطين جديدين وفق الآلية النصف محا فضة (أنظر الآلية..........) نفس الدورة تتكرر عدة مرات نحصل على نسخ عديدة للمورثة.

نقره لعرض الصورة في صفحة مستقلة

3- دمج المورثة في الخلية العائلة:
هذه العملية تحتاج إلى وسيلة ناقلة : في الهندسة الوراثية نستعمل عادة البلاسميد Plasmide : عبارة عن جزيئة ADNحلقية توجد في سيتوبلازم البكتيرية

نقره لعرض الصورة في صفحة مستقلة

يتم فتح البلاسميد بواسطة أنزيم الفصل وبواسطة أنزيم الربط يتم دمج البلاسميد ( يشترط وجود أطراف موحدة بين كل من المورثة والبلاسميد)

نقره لعرض الصورة في صفحة مستقلة

يصبح البلاسميد مركب بعد دمجه للمورثة الدخيلة. يتم بعد ذلك إعادة البلاسميد المركب إلى البكتيرية العائلة بوجود ايونات الكالسيوم. بجوار المورثة البنيوية يتم دمج مورثة منظمة لعملها لكي يتم تعبير المورثة البنيوية.

نقره لعرض الصورة في صفحة مستقلة

4- زرع الخلايا العائلة في مخمرات صناعية:
تهدف هذه العملية إلى جعل الخلية المركبة تتكاثر بهدف إنتاج أكبر كمية من المادة الناتجة عن ترجمة المورثة المدمجة في البلاسميد .نوفر للخلايا المزروعة وسط زراعي أمثل .قبل زرع الخلايا لابد من التأكد من كونها تحتوي فعلا على البلاسميد المركب,نستغل لهذا الغرض خصائص البلاسميد قبل وبعد معالجته.

نقره لعرض الصورة في صفحة مستقلة

لاحظ أن البلاسميد المستعمل هنا يتميز بوجود مورثتين : Amp R (مقومة الأمبيسلين) و Tet R (مقاومة التتراسكلين) بعد دمجه للمورثة الجديدة فقد المورثة الأولى دون الثانية .ادن البكتيرية الحساسة لأمبيسلين والمقاومة لتتراسكلين هي من تتميز بتوفرها على البلاسميد المركب.


__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 02-03-2009, 23:59   #7
Anonyme
زائر
 
الصورة الرمزية Anonyme
 
المشاركات: n/a
افتراضي

شكرا أختي سلوى ....

[CENTER]
رد مع اقتباس
قديم 02-04-2009, 11:44   #8
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي

اقتباس:
المشاركة الأصلية كتبت بواسطة abdelb@sset مشاهدة المشاركة
شكرا أختي سلوى ....
لاشكر على واجب اخي عبدالباسط

__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 02-04-2009, 21:12   #9
educationmaroc
 
الصورة الرمزية educationmaroc
 
تاريخ التسجيل: Dec 2008
العمر: 25
المشاركات: 2,848
نقاط التميز: 356
educationmaroc is a jewel in the rougheducationmaroc is a jewel in the rougheducationmaroc is a jewel in the rougheducationmaroc is a jewel in the rough
افتراضي

شكرا لك عزيزتي سلوى على الدرس المتكامل موفقة
نقره لعرض الصورة في صفحة مستقلة



__________________
نقره لعرض الصورة في صفحة مستقلة
[CENTER]
رد مع اقتباس
قديم 02-04-2009, 21:47   #10
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي

اقتباس:
المشاركة الأصلية كتبت بواسطة Y@ssine مشاهدة المشاركة
شكرا لك عزيزتي سلوى على الدرس المتكامل موفقة
نقره لعرض الصورة في صفحة مستقلة


مشكور عزيزي ياسين على المرور

__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 02-08-2009, 18:37   #11
riham
 
الصورة الرمزية riham
 
تاريخ التسجيل: Feb 2009
المشاركات: 4
نقاط التميز: 0
riham is on a distinguished road
افتراضي

merci bazaf akhouya yassine

[CENTER]
رد مع اقتباس
قديم 02-08-2009, 18:44   #12
educationmaroc
 
الصورة الرمزية educationmaroc
 
تاريخ التسجيل: Dec 2008
العمر: 25
المشاركات: 2,848
نقاط التميز: 356
educationmaroc is a jewel in the rougheducationmaroc is a jewel in the rougheducationmaroc is a jewel in the rougheducationmaroc is a jewel in the rough
افتراضي

شكرا لك أختي ريهام
مرحبا بك معنا مرة أخرى
موفقة

__________________
نقره لعرض الصورة في صفحة مستقلة
[CENTER]
رد مع اقتباس
قديم 02-10-2009, 14:09   #13
arrom
 
الصورة الرمزية arrom
 
تاريخ التسجيل: Feb 2009
المشاركات: 30
نقاط التميز: 70
arrom is on a distinguished road
افتراضي

merci pour le cour ,super

[CENTER]
رد مع اقتباس
قديم 02-10-2009, 17:18   #14
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي

اقتباس:
المشاركة الأصلية كتبت بواسطة arrom مشاهدة المشاركة
merci pour le cour ,super
مشكوراخي على المرور

__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 03-30-2009, 15:46   #15
Soukaina
 
الصورة الرمزية Soukaina
 
تاريخ التسجيل: Dec 2008
المشاركات: 2,042
نقاط التميز: 281
Soukaina is a splendid one to beholdSoukaina is a splendid one to beholdSoukaina is a splendid one to beholdSoukaina is a splendid one to beholdSoukaina is a splendid one to beholdSoukaina is a splendid one to beholdSoukaina is a splendid one to behold
افتراضي رد: بناء مفهوم الخبر الوراثي

(`'•.¸(` '•. ¸ * ¸.•'´)¸.•'´)
«السلام عليكم و رحمة الله تعالى و بركاته »
«.¸. شكرا لكِ عــلى الموضوع. ¸.»
(¸. •'´(¸.•'´ الــرائع و المميز.. `'•.¸)`'•.¸)
«´¨` تحياتي لكِ /´soukaina¨`»

__________________
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة « soukaina



[CENTER]
رد مع اقتباس
قديم 03-30-2009, 16:01   #16
يوسف
 
الصورة الرمزية يوسف
 
تاريخ التسجيل: Dec 2008
المشاركات: 1,305
نقاط التميز: 202
يوسف is just really niceيوسف is just really niceيوسف is just really niceيوسف is just really nice
افتراضي رد: بناء مفهوم الخبر الوراثي

merci pour le sujet

[CENTER]
رد مع اقتباس
قديم 03-30-2009, 18:45   #17
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي رد: بناء مفهوم الخبر الوراثي

مشكورين على المرور

__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 10-16-2009, 18:19   #18
achab toufik
 
الصورة الرمزية achab toufik
 
تاريخ التسجيل: Oct 2009
العمر: 24
المشاركات: 1
نقاط التميز: 0
achab toufik is on a distinguished road
افتراضي رد: بناء مفهوم الخبر الوراثي

merciiiiiiiii

[CENTER]
رد مع اقتباس
قديم 10-23-2009, 16:31   #19
SelOua
 
الصورة الرمزية SelOua
 
تاريخ التسجيل: Dec 2008
الدولة: Īй ʍψ şɨłǝйƈɘ ὼǿяłd
المشاركات: 4,308
نقاط التميز: 503
SelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of lightSelOua is a glorious beacon of light
افتراضي رد: بناء مفهوم الخبر الوراثي

pa de koi
^^


__________________



Pαιηƒυ Sιєη¢є..
Bυт.. Sσмєтιмєѕ Wαѕ Bє Iηƒσямє Oƒ Tнє Tαкιηg




نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
__ŠǝłOʉค

[CENTER]
رد مع اقتباس
قديم 11-05-2009, 12:20   #20
sosokati
 
الصورة الرمزية sosokati
 
تاريخ التسجيل: Jun 2009
العمر: 21
المشاركات: 30
نقاط التميز: 66
sosokati is on a distinguished road
افتراضي رد: بناء مفهوم الخبر الوراثي

شـكــ وبارك الله فيك ـــرا لك ... لك مني أجمل تحية . موفق بإذن الله ... لك مني أجمل تحية .

[CENTER]
رد مع اقتباس
رد

مواقع النشر

المواضيع المتشابهه
الموضوع كاتب الموضوع المنتدى مشاركات آخر مشاركة
الحاسة التي لا تنام أم محمد معلومات ثقافية عامة 10 05-29-2010 21:03
:.كيف تنام بسرعة؟.: SelOua معلومات ثقافية عامة 10 06-06-2009 09:42
هههه احلى توام Engineer Nassimi تسلية وترفيه 10 03-24-2009 12:38
آلية تعبير الخبر الوراثي educationmaroc منتدى التعليم الثانوي 3 02-10-2009 17:23
طبيعة الخبر الوراثي و تموضعه داخل الخلية educationmaroc منتدى التعليم الثانوي 1 02-10-2009 17:08


أدوات الموضوع
طرق مشاهدة الموضوع

تعليمات المشاركة
لا تستطيع إضافة مواضيع جديدة
لا تستطيع الرد على المواضيع
لا تستطيع إرفاق ملفات
لا تستطيع تعديل مشاركاتك

كود BB متاحة
كود [IMG] متاحة
كود HTML معطلة

الانتقال السريع إلى
TSD OFPPT

جميع الأوقات بتوقيت GMT. الساعة الآن 19:28.


[ vBulletin 3.8.0 شبكة التعليم بالمغرب ]